Cell culture
The murine macrophage line RAW264.7 (National Collection of Authenticated Cell Cultures) was cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, #C11995500BT) with 10% foetal bovine serum (Gibco, #10099-141) and 1% (v/v) penicillin/streptomycin (Gibco, #15140-122). Cells were stored at 37 °C in a moist atmosphere with 5% CO2. For osteoclast differentiation, RAW264.7 cells were transferred to 12-well plates at a density of 3 × 104 cells per well, and 50 /mL soluble RANKL (Amizona, #AM1004) was added. The medium was changed every 2 days. In addition, 10 μmol/L GGTI-298 (Cayman, #16176) was used to treat RAW264.7 cells in the following experiment.
Static compression application
RAW264.7 cells were cultured for 3 days and then compressed continuously by a force device as previously described.51 The principle of the compression device is illustrated in Fig. 2. The compression was changed by adjusting the number of steel balls in the container. RAW264.7 cells were subjected to 0.5, 1.0 or 2.0 g/cm2 compression for 1, 2, 4 or 6 h. As a control, cells were maintained without a force device.
Live/dead viability staining
RAW264.7 cells (3 × 104 cells per well) were seeded in 12-well plates for 72 h and subjected to 0.5, 1.0 or 2.0 g/cm2 compression for 1, 2, 4 or 6 h. A calcein/PI cell viability/cytotoxicity assay kit (Beyotime, #C2015S) was used for fluorescence detection. After washes with PBS solution, 500 μL of calcein AM/PI was added to the plate for 30 min in the dark. The living (green) and dead (red) cells were observed under a fluorescence microscope (Olympus, IX73). As cells had optimal viability at 1 g/cm2 of compression for 4 h, we finally chose the above conditions for subsequent experiments.
TRAP staining
TRAP staining was used to observe and evaluate osteoclastogenesis in vivo and in vitro. For TRAP staining in vitro, cells were washed with PBS three times and fixed with 4% paraformaldehyde (PFA, Biosharp, #BL539A) for 30 min. Then, the cells were stained with TRAP staining solution for 15 min at 37 °C, which contained 50 mmol/L sodium tartrate (Sigma-Aldrich, #BCBS5706), 0.1 mol/L sodium acetate buffer (Sigma-Aldrich, #SLCH4856), napthol AS-MX phosphate (Sigma-Aldrich, #SLBV4822), and Fast Red Violet LB salt (Aladdin, #H2110208).
For TRAP staining in vivo, mandible samples were fixed in 4% PFA at 4 °C for 24 h, followed by decalcification with 10% EDTA for 6 weeks and embedding in paraffin. Cross sections were dissected at 5 μm and stained with TRAP staining for 15 min. Methyl green (Sigma, #MKBX8539V) was used to restain the sections for 15 s. The number of osteoclasts was counted in the periodontal tissue of the mesiobuccal root of the upper first molar.
Bone resorption experiments
The bovine bone slices were prepared as previously described.52 RAW264.7 cells were cultured on bone slices in 12-well plates (3 × 104 cells per well). The medium was changed every 2 days. After 7 days of culture, the bone slices were harvested. Then, sonication was used to remove the cells. Samples were then fixed in 4% PFA for 15 min and treated in 0.3% H2O2 (Boster, #16C01A) for 30 min. Slices were dried and coated with gold for SEM detection and viewed at 20 kV. Resorption pit area measurements were performed using ImageJ v2.9.0 software (National Institute of Health). Three views were randomly selected from each slice to examine the number of pits and the resorption pit area.
Immunofluorescence staining
RAW264.7 cells were seeded on a glass coverslip in 12-well plates (5 × 104 cells per well). On day 3, the cells were subjected to 1 g/cm2 compression for 4 h and then fixed in 4% PFA for 20 min. After three washes with PBS, the cells were permeabilized with 0.5% Triton X-100 (Sigma, #SLCD3084) for 30 min and then incubated in blocking buffer (1% BSA, 5% goat serum, and 0.1% Triton X-100) for 1 h. The cells were stained with diluted mouse anti-CD97 (Proteintech, #66972-1-Ig, 1:500) at 4 °C overnight. This step was followed by secondary antibody fluorescent labelling with goat anti-mouse Alexa Fluor 647 staining for 2 h at room temperature, and the nucleus was labelled with DAPI (Solarbio, #C0065) for 1 min. Images were captured by laser scanning confocal microscopy (Olympus, FV3000).
Evaluation of podosome actin belt formation
After 7 days of osteoclast induction, RAW264.7 cells were fixed with 4% PFA at room temperature for 30 min and then permeabilized with 0.1% Triton X-100 (Sigma) in PBS for 15 min. Phalloidin-FITC (Solarbio, #CA1620) was used for podosome actin belt staining for 1.5 h, and then, the cells were counterstained with DAPI (Solarbio, #C0065) for 5 min in the dark. Samples were observed and imaged by inverted fluorescence microscopy (Olympus, IX73).
Quantitative RT‒PCR
Cells were lysed with TRIzol (Invitrogen, #15596-026) for total RNA extraction. The concentration and purity of RNA were tested by a Nano300 microspectrophotometer (Thermo Fisher Scientific). Complementary DNA (cDNA) was synthesised using TaqMan Reverse Transcription Reagents (TaKaRa, #RR047A) according to the manufacturer’s instructions. Hieff qPCR SYBR Green Master Mix (Yeasen, #11201ES08) and gene-specific primers were used to perform qPCR as previously described.53 The primers used in this experiment are presented in Supplementary Table 1.
Western blot
Western blot analysis was performed following standard procedures. In brief, cells were lysed in RIPA buffer (Sabbiotech, #PE001) with protease inhibitor and phosphatase inhibitor. Proteins were separated by SDS‒PAGE (Epizyme, #PG211, #PG212, #PG214) and transferred onto nitrocellulose membranes (PALL, #P-N66485). Then, the membrane was blocked with 5% w/v bovine serum albumin (BioFroxx, #143183) for 2 h and incubated with primary antibodies overnight at 4 °C, including CD97 (Proteintech, #66972-1-Ig, 1:500), Rap1a (Invitrogen, #MA1-013, 1:1 000), ERK1/2 (CST, #34370 S, 1:2 000), pERK1/2 (CST, #4695 S, 1:2 000) and a-tubulin (Proteintech, #11224-1, 1:5 000). The membranes were washed three times with TBST and incubated with the corresponding secondary antibodies (Signalway Antibody, #L3012-1, L3032-1, 1:10 000) for 1 h at room temperature.
Lentivirus-mediated RNAi knockdown
RAW264.7 cells (5 × 104 cells per mL) were cultured in 6-well plates. The next day, the cells were infected with lentivirus carrying three different shRNAs at a multiplicity of infection (MOI) of 25 (GeneChem). In addition, HitransG was added to enhance infection efficiency. The LV-Adgre5-sh1 targeting sequence was GCGTCTGTAACCTGGGATATA; the LV-Adgre5-sh2 targeting sequence was GAGTGTTTACTACCTGGATTT; and the LV-Adgre5-sh3 targeting sequence was CCATAGCACATGGCTATCCTA. RAW264.7 cells were infected with lentivirus for 72 h, and the knockdown efficiency was validated by RT‒qPCR and western blotting. For generation of a fully transduced population of cells, 4 μg/mL puromycin (Solarbio, #P8230) was used to eliminate nontransduced cells.
RNA-seq
Total RNA from cells infected with lentivirus carrying shRNA and negative control was extracted using TRIzol (Invitrogen, #15596-026). An Agilent 2000 Bioanalyzer was utilised to detect the integrity and total amount of RNA, which was purified by magnetic beads enriched with poly-T oligos. Sequencing libraries were generated by the NEBNext ® Ultra™ RNA Library Prep Kit for Illumina® according to the manufacturer’s recommendations. After library quality assessment, different libraries were sequenced on an Illumina HiSeq 6000 machine, and 150 bp paired-end reads were generated. FastQC software was used to control the quality of raw reads and mapped to the Mus musculus genome using HISAT2 (v2.0.5). The differential expression of two conditions/groups was analysed by the DESeq2 R package (1.20.0). Genes were considered significantly differentially expressed if the fold change was ≥1.5 and the adjusted P value was <0.05. GO enrichment analysis of differentially expressed genes and KEGG pathway analysis were implemented by the clusterProfiler R package (3.8.1).
scRNA-seq data analysis
Mouse alveolar bone scRNA-seq data were obtained from Sequence Read Archive (SRA) datasets (https://www.ncbi.nlm.nih.gov/sra/) via accession number PRJNA697839. The periodontal ligament scRNA-seq dataset (GSE160358) can be downloaded from the GEO database (https://www.ncbi.nlm.nih.gov/geo/). For the scRNA-seq analysis, the gene expression matrix of scRNA-seq data was downloaded and loaded into the Seurat package (v4.1). For quality control, cells with mitochondrial genes higher than 25% and fewer than 200 expressed genes were filtered out. Principal component analysis (PCA) was performed. The cells were divided into different subclusters with the FindClusters function at resolution = 1, and then, uniform manifold approximation and projection (UMAP) (dims = 1:30) was performed based on the PCA results to visualise the data. Cell types of different subclusters were annotated by specific marker genes using the FindVariableGens function. To determine the expression of aGPCR in various cellular components in the periodontium and alveolar bone, we selected 33 aGPCR genes for visualisation.
Animal models
This study was approved by the Committee on Animal Research of Hebei Medical University (Approval number: 2023044). The ARRIVE (Animal Research: Reporting of In Vivo Experiments) guidelines were followed throughout the experiment. Male C57/BL6 mice (20–25 g, 8 weeks old) were purchased from Beijing HFK Bio-Technology. All animals were kept in the Hebei Key Laboratory of Stomatology at Hebei Medical University under standard pathogen-free conditions in a 12 h light-dark cycle. The OTM model was established as previously described.54 Briefly, mice were anaesthetised by pentobarbital sodium. The anaesthetic dose, administered intraperitoneally, was 40‒50 mg/kg body weight. For induction of OTM, 3 mm nickel-titanium spiral springs (IMD, #OS1218) were ligated between the left maxillary first molar and incisors and generated 10 g orthodontic force under activation. The contralateral side served as a control. Dental light curing flowable composite resin (SPIDENT, EsFlow A3) was used to prevent spring detachment. Animals were fed a soft diet to relieve discomfort. The appliances were assessed daily, and rebonding was performed if the spring fell off or was damaged. Six mice were sacrificed after application of orthodontic force for 0, 3, and 7 days. Tooth movement distance and histological evaluation was conducted in a single-blind manner.
Injection of Rap1a inhibitor GGTI298
The orthodontic force was applied to both sides of the maxillary first molars and incisors. The mesial periodontium of the left side was injected with 25 μL of GGTI298 (Cayman, #16176; 50 μg/mL), and the right side was injected with an equivalent amount of PBS at the same site (n = 6). The rats were injected every 2 days during the experiments. The mice were sacrificed after the application of orthodontic force for 7 days.
Micro-CT analysis
Mouse maxillae were harvested on day 0, day 3 and day 7 of the experiment and fixed in 4% PFA for 24 h. Samples were scanned by a Venus micro-CT system (PINGSHENG Healthcare) with a spatial resolution of 8 μm (90 kV, 65 μA). The three-dimensional structure was reconstructed by Avatar software. The tooth movement distance was measured in relation to the contact point of the distal-marginal ridge of the first maxillary molar and the mesial-marginal ridge of the second molar.55
Histological immunofluorescence staining
Mandible samples including molars were fixed in 4% PFA at 4 °C for 24 h and decalcified with 10% EDTA for 6 weeks. Cross sections were dissected at 5 μm. Antigen retrieval was conducted in sodium citrate buffer (Solabio, #C1032) at 99 °C for 15 min. Then, the slides were incubated with diluted mouse anti-CD97 (Santa Cruz, #sc-166852, 1:500) and anti-F4/80 (Abcam, #ab6640) at 4 °C overnight. The sections were incubated with the specific secondary antibodies at room temperature and stained with DAPI for 5 min. The images were observed and captured under laser scanning confocal microscopy (Olympus, FV3000).
Statistical analysis
All data are expressed as the mean ± SD. Unpaired two-tailed Student’s t tests were performed for comparisons between two groups. One-way ANOVA or two-way ANOVA followed by Tukey’s test for multiple comparisons was used to assess differences between groups. P < 0.05 was considered statistically significant. All statistical analyses were performed with Prism 9.0 (GraphPad, Inc.).
